Description:
HTT-Q39-PCDNA3.1, 1-90, T3D
|
Repository
|
HD Community Biorepository
|
| Quantity |
20 µg |
| Quantitation Method |
Please see our FAQ |
| Certain Third Party Licensing Requirements |
Invitrogen License for Cat# V790.20 |
|
Alias
|
Htt-Q39-pcDNA3.1, 1-90, T3D
|
|
Family History
|
N
|
|
Remarks
|
|
| Remarks |
DNA corresponding to the Exon 1 (1-90) human sequence of the Huntingtin gene (Htt) containing 39 polyglutamine repeats and a T3D mutation |
| Construct Name |
Htt-Q39-pcDNA3.1, 1-90, T3D |
| Insert Length |
351 |
| Vector |
pcDNA3.1 |
| Concentration |
140 ng/mL |
| Sequence |
GGTACCGCCGCCACCatggcggacctggaaaagctgatgaaggccttcgagtccctcaa gtccttccaacagcagcaacagcaacaacagcagcaacagcaacaacagcagcaacagc aacaacagcagcaacaacag cagcaacagcaacaacagcagcaacagcaacaacagca gcagcaaccgccaccgccgccgccgccgccgccgcctcctcagcttcctcagccgccgc cgcaggcacagccgctgctgcctcagccgcagccgcccccgccgccg cccccgccgcc acccggcccggctgtggctgaggagccgctgcaccgaccaggatcctgataaTCTAGA
|
| Cloning Information |
|
| Remarks |
DNA corresponding to the Exon 1 (1-90) human sequence of the Huntingtin gene (Htt) containing 39 polyglutamine repeats and a T3D mutation |
| DNA corresponding to the Exon 1 (1-90) human sequence of the Huntingtin gene (Htt) containing 39 polyglutamine repeats and a T3D mutation |
| Remarks |
DNA corresponding to the Exon 1 (1-90) human sequence of the Huntingtin gene (Htt) containing 39 polyglutamine repeats and a T3D mutation |
| PDF |
Vector Map |
|
Plasmid Collection Screening and Propagation |
| Supplement |
- |
|
|